circad | circRNAs associated with diseases

hsa_circ_0003159
Gene	CACNA2D1	Organism	Human
Genome Locus	chr7:81689743-81746489:-	Build	hg19
Disease	Digestive System Neoplasm	ICD-10	Overlapping lesion of digestive system (C26.8)
DBLink	Link to database	PMID	28618205
Experimental Method
Sample Type	Tissues	Comparison	paired fresh gastric cancer tissues and adjacent non-tumorous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACTGGGAATGGAGGAAGA Reverse TGAGAAAGGATTGAGGGAAAAG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Tian, M, Chen, R, Li, T, Xiao, B (2018). Reduced expression of circRNA hsa_circ_0003159 in gastric cancer and its clinical significance. J. Clin. Lab. Anal., 32, 3:no page given.